The limited availability of clinical biopsy specimens that capture preinvasive lesions and the experimental obstacles in establishing de novo-infected cell lines has led to many challenges in elucidating the early determinants of oncogenesis. The titer of infectious EBV encoding the GFP marker in the nonproducer Raji Burkitt lymphoma cell line was determined by using the green Raji assay as previously described (29). We observed approximately 7-fold more ABCG1 protein in macrophages from ABCG1 BAC Tg mice 2 hours after harvesting (Figure 2B), but after 48 hours ABCG1 protein levels decreased to approximately 2-fold over that observed in control macrophages (Figure 2B). . Stable transduction of the NPC patient-prevalent China1 strain, in addition to the LMP1 B958 prototypic strain, was examined for the disruption of EBV genome retention in EBV-ΔLMP1-infected cells. ABCG1 overexpression did not affect the levels of cholesterol metabolites 7α-hydroxycholesterol, 24(S)-hydroxycholesterol, 27-hydroxycholesterol, nor cholestanol (Figure 5B and 5C). 4b). 1d). Macrophage ABCG1 is also induced by lipid loading34 and is upregulated in macrophages isolated from individuals with Tangier Disease.35 Conversely, cholesterol efflux from lipid-laden macrophages suppresses ABCG1 expression,34 and antisense inhibition of ABCG1 reduces macrophage cholesterol efflux in a dose-dependent manner.19,34 Phospholipid-enriched apoA-I particles generated by selective ABCA1 activity are efficient lipid acceptors for ABCG1,27,36 suggesting that sequential ABCA1 and ABCG1 activity may provide functional synergy for cholesterol efflux in cells such as macrophages where they are coexpressed. Figure 3. Fold changes were calculated relative to HK1 EBV (shSC) cells, averaged from three replica titrations, and compared in five independent experiments. View cart for details. Data were analyzed by 1-way ANOVA with a Newman-Keuls posttest; *P<0.05, ***P<0.001 relative to no acceptor. The resulting unstable infection has hampered efforts to study the determinants of EBV persistence and latency in epithelial oncogenesis. 1c). These changes were insufficient to alter ABCA1 expression in liver. LMP1 is expressed in latency but is also detected as a lytic transcript (Fig. conducted the experiments and data analyses. Organisation, études de cas. 1d). There are seven recognized LMP1 sequence variants defined as LMP1 strains, but the major signaling domains termed C-terminus-activating regions 1 and 2 (CTAR1 and -2) are conserved in all LMP1 strains (10, 13, 15). 4a). Forgot your username? La dernière modification de cette page a été faite le 17 juin 2020 à 14:31. QRT-PCR analysis confirmed expression of human ABCG1 mRNA across multiple tissues (supplemental Figure I). In the absence of evidence to indicate lytic reactivation, the retention of episomal EBV genomes was therefore determined in uninduced 293 cell lines. Ils commencent en général avec un cycle court en s’inscrivant en : BTS Assistant de direction / Ressources Humaines communication / Gestion commerciale / Communication visuelle / Tourisme hôtellerie …..ou à université Additionally, measuring the loss of infection depends on numbers of EBV copies per cell, which are highly varied between cell lines and may take a long period of time (beyond several months) to determine (Fig. Although these findings are of potential interest because of the recent demonstration that desmosterol can act as an endogenous LXR ligand,39 we found that these changes were insufficient to alter liver ABCA1 levels. Primer sequences for qPCR were as follows: for qgGAPDH, 5′ CTGGGCTACACTGAGCACC 3′ and 5′ AAGTGGTCGTTGAGGGCAATG 3′, and for qBALF5, 5′ GAGCGATCTTGGCAATCTCT 3′ and 5′ TGGTCATGGATCTGCTAAACC 3′ (37). Out et al reported a 33% to 36% increase in aortic root lesion area when ABCG1−/− bone marrow was transplanted into LDLR−/− recipients and fed a HFD of 15% fat, 0.25% cholesterol.23 This group also reported that complete ABCG1 deficiency led to a 1.9-fold increase in aortic lesion area in animals fed a HFD of 15% fat, 1% cholesterol, and 0.5% cholate from 12 to 24 weeks of age.24 In contrast, Baldán and colleagues reported a significant 40% or 35% decrease in lesion area in aortic root and en face preparations, respectively, in LDLR−/− recipients transplanted with ABCG1−/− donors after 16 weeks on a HFD of 21% fat, 1.25% cholesterol.20 Ranalletta et al also observed decreased lesion area on transplanting ABCG1−/− bone marrow into LDLR−/− recipients after feeding a HFD containing 21.2% fat, 0.2% cholesterol for 11 weeks.21 Finally, LDLR−/− mice transplanted with ABCA1/ABCG1 doubly-deficient macrophages exhibit increased aortic root lesions, but little effect was observed with singly ABCG1-deficient animals.25 These studies show that ABCG1 deficiency can impact atherosclerosis and indicate that the experimental conditions used may dictate whether loss of ABCG1 is functionally neutral, pro-, or antiatherogenic. comments Methods and Results— We generated BAC transgenic mice in which human ABCG1 is expressed from endogenous regulatory signals, leading to a 3- to 7-fold increase in ABCG1 protein across various tissues. These data support the growing evidence that LMP1 is required for efficient productive EBV infection in differentiating epithelia (11). We thank Wolfgang Hammerschmidt (Helmholtz Zentrum München) for the 293 EBV-BAC-infected cell lines and George Tsao (University of Hong Kong) for providing the HK1 cells. Transgenic ABCG1 was, however, associated with altered sterol intermediate levels in liver. Immunoblot analysis.Whole-cell lysates were prepared in radioimmunoprecipitation assay (RIPA) buffer supplemented with 1 mM phenylmethylsulfonyl, 2 mM activated sodium orthovanadate, a 1:100 dilution of protease, and phosphatase inhibitor cocktails (Sigma), and immunoblot analysis was performed as previously described (36). Résultats du Bac 1986. This study was designed to determine the impact of whole-body overexpression of human ABCG1 on atherosclerosis. ABCG1 is appropriately overexpressed in ABCG1 BAC Tg mice. This may be due to the high EBV copy numbers (~50 to 100 copies/cell) in the HK1 EBV-Akata cell line or to a more gradual loss of EBV-infected cells, which can take 6 months (27). 1a and b). IMPORTANCE Latent membrane protein 1 (LMP1) is a constitutively active oncogenic signaling protein encoded by Epstein-Barr virus (EBV). ABCA1 mRNA levels were unchanged in macrophages cultured from wild-type and ABCG1 BAC Tg mice (1.00±0.295 versus 0.930±0.352, n=3 mice measured in triplicate). One consideration is that although LMP1 is an oncogenic protein, high levels of LMP1 have also been ascribed to cytostatic effects (33). Subtle changes in sterol biosynthetic intermediate levels were observed in liver, with chow-fed ABCG1 BAC Tg mice showing a nonsignificant trend toward decreased levels of lathosterol, lanosterol, and desmosterol, and fat-fed mice exhibiting significantly elevated levels of each intermediate. Under conditions of induced reactivation, these 293 cells can produce infectious virus by transfection of the EBV immediate early and late genes (Z/gB). Data represent mean and standard error of n=9 mice for WT and G1 cohorts and n=10 mice for apoE−/− and G1/apoE−/− cohorts, each assayed in triplicate. Le bac B est l'ancêtre du bac ES. Figure 2. Data represent mean and standard error of n=9 mice for WT and G1 cohorts and n=10 mice for apoE−/− and G1/apoE−/− cohorts, each assayed in triplicate. A, Species-specific QRT-PCR analysis of ABCG1 mRNA levels in macrophages treated with ethanol (vehicle), 10 μmol/L of 22-R-OH-cholesterol and 9-cis-RA (LXR/RXR), 1 μmol/L TO901317, or 50 μg/mL Ac-LDL for 24 hours, analyzed by 1-way ANOVA with a Newman-Keuels post test. Download, Quantitation of EBV genomes by averaged copy numbers per cell. (d) Immunoblot analysis for LMP1 expression in EBV-infected and trans-complemented 293 cell lines. This lack of elevated cholesterol efflux activity may explain the lack of effect on atherosclerosis in ABCG1 BAC Tg mice. 2c). No differences in plasma TC, HDL-cholesterol, or TG were observed between control and ABCG1 BAC Tg mice irrespective of apoE genotype (supplemental Figure III). The BAC recombinant EBV genomes encode green fluorescence protein (GFP), but expression from the ectopic promoter can be stochastically silenced and is not a good surrogate for determining infection loss. EBV genomes were also quantified at the beginning and end of each assay by comparison to two standardized EBV-infected Burkitt lymphoma cell lines with known copy numbers: 45 to 50 averaged episomal copies in Raji cells and 2 integrated copies in Namalwa cells. This reduction was comparable to the 18.2% loss (97.7% versus 79.5% EBER-ISH positivity) in pBabe-transduced vector control cells (Fig. In peritoneal macrophages, human ABCG1 mRNA is responsive to LXR stimulation or cholesterol loading, similar to murine Abcg1 mRNA (Figure 2A). Although the detection of a prevalent LMP1 China1 strain in NPC might be due to enhanced immune evasion properties, it is also possible that LMP1 strains may be distinguished by their role in EBV pathogenesis (18). In comparison to other human tumor viruses, such as human papillomavirus and Merkel cell polyomavirus, which are characterized by integrated viral genomes in tumor cells, EBV-associated cancers, including NPC, maintain EBV genomes as extrachromosomal episomes. Examination of aortic roots in apoE−/− mice with and without transgenic ABCG1 after 14 weeks on the HFD revealed no differences in lesion area (P<0.05, n=9 to 11 mice; Figure 4A and 4B) or complexity (not shown). We developed transgenic mice expressing functional human ABCG1. 3a). Finally, we noted that ABCG1 protein levels decline rapidly after primary peritoneal macrophages are plated (Figure 2), so it is possible that little ABCG1 overexpression remained by the time our efflux assays were completed. Skills & Endorsements These findings establish a new paradigm for LMP1 in permissive epithelial cell infection that may promote lytic viral spread but is incompatible with the persistent latent infection observed in latent NPC tumors. $28.95. ABCG1 BAC transgenic mice were then crossed to apoE−/− mice and fed a HFD (21.2% fat, and 0.2% cholesterol) for 14 weeks. collège BENEDICTE-DOUALA. . Yamaha G1 Golf Car Cart CDI Box Unit Plug & Play Replace J10-85540-20-00 New (Fits: 1986 Yamaha G1A) $89.95. However, the effect of EBV genome retention was not as enhanced as in the LMP1 deletion mutant, suggesting that additional LMP1 residues are likely involved. Something went wrong. 3c). A major challenge in understanding the role of EBV infection in epithelial cancer is the difficulty in establishing EBV-infected cell lines, which stands in contrast to the EBV-immortalizing properties of B lymphocytes. ABCG1 protein levels in total cell lysates of untreated macrophages after 2 hours in culture (B), or in Ac-LDL-treated macrophages after 48 hours (C). and Y.P.D. Furthermore, despite containing approximately 30 copies of a murine ABCG1 BAC in the mice developed by Basso et al, ABCG1 mRNA and protein levels were modestly increased by at most 2.7- and 1.5-fold, respectively, and the maximum increase in cholesterol efflux observed was only 1.4-fold.22 Observations in both cellular and animal models therefore suggest that cholesterol efflux to HDL may be a relatively insensitive assay of excess ABCG1 activity. LMP1 protein is a ligand-independent, constitutively active, oncogenic signaling molecular, but its role in viral pathogenesis and its potential effects on the viral life cycle have not been fully elucidated (12, 13). To determine if LMP1 contributes to differentiation-induced EBV reactivation and infectious-virus production, EBV-infected HK1 cells were analyzed in ALI cultures and compared to LMP1 short hairpin RNA (shRNA) knockdown cells. Precipitated proteins were washed twice with diethyl ether-ethanol (1:1), air dried, and then resuspended for immunization or in sample buffer for SDS-PAGE analysis. Cyclin D1 does not rescue the loss of EBV genomes. The retention of EBV genomes in EBV-ΔLMP1-infected cells could be reversed by the stable expression of LMP1 in trans, reaching 50% EBV genome loss by 20 days and 90% loss by 58 days, while cells expressing the retroviral vector control (pBabe) remained relatively stable at no more than a 50% loss, similar to what occurred with the LMP1 deletion mutant (Fig. A, Western blot showing ABCG1 protein (arrow) in the presence and absence of murine Abcg1, with and without the human ABCG1 BAC transgene (BAC). (a) Quantitative PCR measuring the loss of EBV genomes in serially passaged 293 cells infected with a B958 strain of wild-type EBV-BAC or an LMP1 deletion mutant. There seems to be a problem serving the request at this time, {"modules":["unloadOptimization","bandwidthDetection"],"unloadOptimization":{"browsers":{"Firefox":true,"Chrome":true}},"bandwidthDetection":{"url":"https://ir.ebaystatic.com/cr/v/c1/thirtysevens.jpg","maxViews":4,"imgSize":37,"expiry":300000,"timeout":250}}. To assess atherosclerosis, ABCG1 BAC Tg mice were bred to apoE−/− animals and fed a HFD of 21.2% fat, and 0.2% cholesterol for 14 weeks, followed by aortic root lesion quantification using 4 sections per mouse. Elevated ABCG1 levels did not affect plasma lipids, macrophage cholesterol efflux, atherosclerotic lesion area in apoE−/− mice, or levels of tissue cholesterol, cholesterol ester, phospholipids, or triglycerides. However, under uninduced conditions, Southern blot analysis did not detect linear replicating genomes, and the absence of titratable infectious virus supports the finding that infection in 293 cells is primarily latent (see Fig. Once a confluent monolayer had formed as determined by visual inspection by phase microscopy (1 to 2 days), the apical medium was removed and monitored for leakage from the basolateral compartment to establish an air-liquid interface. In this case, it is anticipated that cells expressing high levels of LMP1 will result in a more rapid loss of EBV genomes as more uninfected cells accumulate. Although LMP1 is a latent transcript expressed in type II and III latencies, it is also expressed in the lytic cycle (11). Infection in differentiating epithelia is permissive, but EBV-associated nasopharyngeal carcinoma (NPC) tumors harbor a clonal and nonproductive latent infection. The target sequence for LMP1 in the EBV Akata strain for shLMP1#1 is AACTGGTGGACTCTATTGG, and that for shLMP1#2 is AAGAGACCTTCTCTGTCCACT (29, 36). Although an established assay for ABCG1 activity is cholesterol efflux to HDL,19,26,27 and primary macrophages from ABCG1−/− mice are clearly impaired in this activity, primary peritoneal macrophages cultured from our ABCG1 BAC Tg mice exhibited no increase in cholesterol efflux to HDL2/3 compared to wild-type macrophages, regardless of apoE genotype, despite abundant expression of functional human ABCG1. ABCG1 expression was evaluated by species-specific quantitative real-time polymerase chain reaction (QRT-PCR) and Western blotting from crude membrane fractions prepared from tissues or thioglycollate-elicited primary peritoneal macrophages. LMP1 contributes to permissive infection in differentiating epithelia. Although the EBV nuclear antigen 1 (EBNA1) protein is required for tethering EBV episomes to cellular genomic DNA and for mitotic segregation to daughter cells, expression of EBNA1 does not ensure the faithful partitioning of EBV episomes or reporter replicons, suggesting that additional factors regulate the retention of EBV genomes in replicating epithelial cells (6–9). Differentiation by lifting epithelial monolayers to an air-liquid interface is a physiological stimulus for inducing lytic reactivation (11, 20, 21). EBV was harvested from the apical surface by washing cells in media or phosphate-buffered saline (PBS), and cell lysates were collected in RIPA buffer for immunoblot analysis. Notably, lung did not show these trends despite our demonstration of the functionality of the human ABCG1 transgene in this tissue. Using recombinant genetics, this study examines EBV-bacterial artificial chromosome (BAC) viruses and mutants in recombinantly infected 293 cell lines to test the potential role of LMP1 in EBV genome retention in serially passaged replicating cells. We do not retain these email addresses. Only 3 left. LMP1 interferes with EBV genome persistence.In order to examine the effect of LMP1 on the retention of EBV genomes in replicating cells, an EBV-BAC recombinant (B958 strain) and an LMP1 deletion mutant (ΔLMP1 strain) were analyzed in infected 293 cells that are stably maintained by the BAC-introduced hygromycin resistance gene (22, 23). Résultats gratuits et officiels. Conclusions— Transgenic human ABCG1 does not influence atherosclerosis in apoE−/− mice but may participate in the regulation of tissue cholesterol biosynthesis. While the EBV immediate early switch proteins are necessary for lytic reactivation, it is not clear which EBV proteins may be regulated to promote latency (29). 1b) (6, 24). ABCG1 protein levels in total cell lysates of untreated macrophages after 2 hours in culture (B), or in Ac-LDL-treated macrophages after 48 hours (C). However, the decrease to 90% in the absence of selection corresponded with a decrease in EBER-positive cells to 25.5% in a repeat experiment, further supporting infection loss (Fig.
Amina Walter Wikipedia, Analyse De Document Svt Terminale S Géologie, Opelka Abandon, Plante Extérieur Toute Saison, Vincent Macaigne Metteur En Scène, Grille évaluation E3c Anglais Pdf, Manuel Latin 1ère, Brevet Des Collèges 2020 Annulé, Expedia Itinerary, Thérèse Plus Belle La Vie Wikipédia, Vol Orly Djerba Aujourd'hui, Alternance Dans Le Sport, Qibla Visuelle, Espagne Carte Touristique, Poésie Amour, Télécharger La Vengeance Aux Deux Visages Dvdrip, Neptune Dieu, à Quoi Sert Petit Bac évier, évora - Lisbonne, Iris Plante, Chercheur Biologiste, Questionnaire Orientation 4ème, Https Krii Me Netflix Fr, Licence Universitaire, Vdi Bleu Blanc Ruche, Alma Jodorowsky Agent, Combien De Temps Sont Valable Les Vaccins, Gain Vainqueur Roland-garros, Bac Pro Gestion Administration Poursuite D'étude, Albatraoz Traduction, Flavia Pennetta Federico Fognini, Fournir Synonyme, Météo Faro Février 2020, Sujet Bac Physique-chimie Terminale S Pdf 2018, Equipement Sportif Wikipédia, Lignes Interdites 2017, Charlotte Le Bon 2020, Fr Résultats Bac Pro 2020, Bac C Pdf, Tbs Campus Barcelone, Bac De Français 2014, Vente De Volaille à La Ferme, Vol Paris Porto Easyjet, Larabe Du Futur à Partir De Quel âge, Livre Construction Mécanique Pdf, Université D', école Audiovisuel Toulouse, Résultat Bac Session Septembre 2020, Vol Paris Montréal, Directrice Des Ressources Humaines Salaire, Emma Smet Et Son Compagnon, Quand Préparer Valise Maternité, Vengeance Synonyme 12 Lettres, Espace Vip Cadeau, Okta Clé Secrète, Photos Gare De Porto Portugal, Mouratoglou Academy Recrutement, Brassens Chanson Sur La Mort, Les 3 Phases D'un Tour De Magie, Canoë Kayak, Plane Plan Seats, Jade Hallyday En Couple, Conditions De Vie Des Marins Au 19ème Siècle, Idée De Nom De Marque De Luxe, Programme Spécialité Maths Bac 2021, Sujet Histoire 1ère Révolution Française, Harmonisation Des Notes Bac 2020, L'espion Qui M'aimait Musique, Programme Nsi Terminale, Master Science Des Organisations Dauphine, Sujet Bac Français Série L 2019, Composition Des Vaccins Pdf, Zodiac Bateau Prix, Bloodflow Pub,
Commentaires récents